 Methods for determining the therapeutic efficacy of rapid-acting antidepressants and personalized an
专利摘要:
The present invention relates to the fields of life sciences, medicine, monitoring, therapies and drug screening and development. Specifically, the invention relates to a method for determining the therapeutic efficacy of a rapid-acting antidepressant, a real-time method of optimizing antidepressant treatment and a method of screening novel rapid-acting antidepressants and/or plasticity enhancers. Still, the present invention relates to a method of treating a subject with a rapid-acting antidepressant. 公开号:FI20176142A1 申请号:FI20176142 申请日:2017-12-21 公开日:2019-06-22 发明作者:Tomi Rantamäki；Samuel Kohtala；Wiebke Theilmann 申请人:Helsingin Yliopisto； IPC主号:
专利说明:
Methods for determining the therapeutic efficacy of rapid-acting antidepressants and personalized antidepressant therapy related thereto FIELD OF THE INVENTION The present invention relates to the fields of life sciences, medicine, monitoring, therapies and drug screening and development. Specifically, the invention relates to a method for determining the therapeutic efficacy of a rapid-acting antidepressant, a real-time method of optimizing antidepressant treatment and a method of screen10 ing novel rapid-acting antidepressants and/or plasticity enhancers. Still, the present invention relates to a method of treating a subject with a rapid-acting antidepressant. BACKGROUND OF THE INVENTION Major depression is a highly disabling psychiatric condition, the most significant risk factor for suicide and one of the biggest contributors to the disease burden worldwide. Depressive disorders produce immeasurable human suffering and enormous economic burden. Depressed mood, anhedonia, lack of concentration, feelings of worthlessness and suicidal thoughts are common symptoms of depression. Yet, 20 conventional antidepressants alleviate these symptoms very slowly, if at all. Indeed, many patients don't respond to prescription antidepressants, and in those who do the therapeutic effects become evident with a considerable delay. The huge unmet medical need for better antidepressants is evidenced by the ongo25 ing medical use of electroconvulsive therapy (ECT). An electric current leading into a short epileptic-like of EEG (electroencephalogram) activity is delivered in ECT under light anesthesia, but how this seizure leads into a remedy remains poorly understood. The therapeutic effects of ECT emerge faster than those of conventional antidepressants, yet rapid reduction of depressive symptoms already after a single 30 ECT treatment is only seldom reported. Rapid antidepressant effects of subanesthetic ketamine has been well established in clinical trials and the treatment is already in off-label use in various countries, including the USA. Reported response rates to ketamine are somewhat impressive, 35 but significant amounts of patients remain treatment-refractory (Aan Het Rot et al. 2012, Biol. Psychiatry 72, 537-547). To this end, extensive research input has been 20176142 prh 21 -12- 2017 put forward to find predictive efficacy markers and to uncover the precise neurobiological basis underlying the rapid antidepressant effects of ketamine. Although categorized as a non-competitive NMDA (/V-methyl-D-aspartate) receptor antagonist, ketamine has rich pharmacology and regulates several other targets as well includ5 ing the AMPA (a-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid), the opioid and the cholinergic receptors, several ion channels and enzymes. Intriguingly, a recent animal report suggests that it is the metabolic byproduct of ketamine, a putative positive AMPA receptor modulator cis-6-hydroxynorketamine (HNK), which is solely responsible for the rapid antidepressant effects of ketamine (Zanos P et al. 2016, 10 Nature 533, 481-486). Despite promising animal studies, potential rapid antidepressant effects of positive AMPA receptor allosteric modulators have not been thoroughly assessed in clinical trials. Rapid antidepressant effects of N2O (nitrous oxide or laughing gas), another NMDA 15 receptor blocker, have also been studied. Nagele et al have published a research article (Nagele et al, 2015, Biol. Psychiatry vol. 78, pages 10-18) and have filed a patent application (publication WO2015/175531 A1) regarding the use of N2O (575%) as a sole agent or in combination with other specific drugs and treatments for the treatment of depressive disorders. The neurobiological mechanism underlying 20 the therapeutic effects of N2O remain, however, obscure. On the other hand, systems and methods for use in characterization and discovery of neuroactive drugs have also been published. E.g. WO2016/029211 A1 describes a system for evaluating an effectiveness of one or more drugs administered to a 25 subject. Said system utilizes analyzes of the neurophysiological data to generate signatures indicative of brain states induced by one or more drugs administered to the subject. Furthermore, US 2012/0165696 A1 describes a method for assessing the susceptibility of a human individual suffering from a psychiatric condition or neurological disorder to neuromodulation treatment, wherein said method comprises 30 the use of electroencephalographic (EEG) dataset. There is, however, no biomonitor, whether based on neurophysiological measure or biological readout, in the clinical domain that would reliably predict or optimize rapid antidepressant effects. There is a need to better understand rapid antidepressant mechanisms and to find 35 predictive biomarkers to control their efficacy. There also remains a significant unmet need for more effective and safer therapies alleviating the symptoms of depressive disorders. 20176142 prh 21 -12- 2017 BRIEF DESCRIPTION OF THE INVENTION One object of the present invention is to provide methods and tools for systematic 5 testing of the antidepressant effects in clinical and preclinical settings. Another object of the present invention is to provide tools and a method for effective and specific treatment of depressive disorders. The objects of the invention are achieved by utilizing a surprising and a simple biomarker for planning and optimizing personalized antidepressant therapy. Defects of the prior art, including but not limited to in10 effective rapid-acting antidepressant treatments and lack of straightforward, reliable and safe monitoring methods in the living brain, are thus overcome by the present invention. It has now been found that it is possible to predict the individual therapeutic re15 sponses to a rapid-acting antidepressant by analyzing time-lapsed changes in specific neurophysiological markers in real-time after administering said treatment. The results of the monitoring enable prediction of the therapeutic efficacy and optionally outcome of the rapid-acting antidepressant treatment in said subject. The present invention thus enables real time monitoring combined with optimized treatment in 20 any subject. As an example, a subject who does not benefit from a standard rapidacting antidepressant treatment or its specific dosing regimen may be found quickly after administration of said antidepressant and thus the treatment may be modified for optimal outcome or replaced for another treatment very early. In particular, the present invention discloses a method allowing to rapidly modify and adjust the ther25 apeutic effects of a rapid-acting antidepressant and to reproduce evoked brain responses beneficial against depression in remarkable precision and timescale. Therefore, the present invention provides a very effective and personal antidepressant efficacy biomonitoring tool. The results of a study presented in this disclosure encourage systematic testing of time-lapsed slow neural oscillations as reliable efficacy monitors of the antidepressant effects in clinical settings. The present invention is based on the idea of providing a method, wherein slow neural oscillations from the cortex of the brain are monitored by electrophysiological monitoring (e.g. using the EEG), in real-time, in a spe35 cific embodiment in a non-invasive way. Indeed, the present invention solves the problems of conventional unsuccessful, slow and unspecific therapies. The present 20176142 prh 21 -12- 2017 invention surprisingly reveals predictive efficacy markers to be utilized in antidepressant treatment, e.g. optimizing an antidepressant treatment. The present invention may also be utilized for development of novel rapid-acting antidepressants e.g. in clinical and preclinical settings. There is currently no method in the clinical domain that would reliably predict rapid antidepressant efficacy or any specific method to optimally titrate the dosing of rapid antidepressant in each patient. The present invention overcomes said deficiencies. Moreover, intermittent dosing consisting of repeated exposures to rapid-acting anti10 depressants with short intervals during the same treatment session are enabled by the present invention. Indeed, it has now been surprisingly found that an interplay between “excitation” (E) and “inhibition” (I) in the cortex of the brain can be utilized for determining the ther15 apeutic efficacy of rapid-acting antidepressants. The present invention enables coupling of cortical excitability and resulting rebound slow neural oscillations for studying the effects of rapid-acting antidepressants. The results of the present disclosure show that transient regulation of cortical excitability and emerged slow neural oscillations evoked by such excitability is a shared neurobiological phenomenon for treat20 ments that can bring immediate amelioration of depressive symptoms (see e.g. Figures 13 and 14). Remarkably, such homeostatic transient alterations in E-l balance can be rapidly reproduced with specific pharmacological and/or non-pharmacological means. The present invention enables reproducible and efficient production of rapid antidepressant effects. By the present invention it is possible to produce and rapidly reproduce brain states, which are beneficial against depression or other nervous system disorders associated with compromised plasticity (as used herein brain plasticity refers to lasting change of the brain). Actually, the present invention is based on 30 methods and means to reliably and effectively control and monitor produced excitatory and inhibitory responses in the brain and optionally to rapidly and repeatedly reproduce said responses. Further, the present disclosure shows association between ongoing regulation of 35 TrkB and 6δΚ3β signaling pathways and slow neural oscillations. Also, a surge of 20176142 prh 21 -12- 2017 glutamatergic neuronal excitability and synthesis of plasticity-related activity-dependent immediate early genes (e.g. Arc, Bdnf) is pointed out as a shared neurobiological feature for rapid-acting antidepressants. In short, effects of rapid antidepressants can be studied and optimized by utilizing the present invention and furthermore by aid of the present invention it is possible to develop novel more efficient treatments against depression and other treatments wherein antidepressants and induced plasticity is considered beneficial. The present invention relates to a method for determining a therapeutic efficacy of a rapid-acting antidepressant, wherein the method comprises: monitoring slow neural oscillations from the cortex of the brain of a subject administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring, and determining a therapeutic efficacy of said rapid-acting antidepressant(s) based on fluctuations (e.g. dynamic fluctuations) on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) after the administration under the influence of said rapid-acting antidepressant(s) in said subject. Also, the present invention relates to a real-time method of optimizing antidepressant treatment, wherein the method comprises monitoring slow neural oscillations from the cortex of the brain of a subject administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring, and determining a therapeutic efficacy of said rapid-acting antidepressant(s) based on fluctuations (e.g. dynamic fluctuations) on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) after the administration under the influence of said rapid-acting antidepressant(s) in said subject, and optimizing the rapid-acting antidepressant treatment. Still, the present invention relates to a method of screening novel rapid-acting antidepressants, wherein the method comprises monitoring slow neural oscillations from the cortex of the brain of a subject administered with a pharmaceutical by electrophysiological monitoring, and determining a rapid-acting antidepressant therapeutic efficacy of said pharmaceutical based on fluctuations (e.g. dynamic fluctuations) on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) 20176142 prh 21 -12- 2017 after the administration under the influence of said pharmaceutical and/or other intervention in said subject. Still further, the present invention relates to a method of treating a subject with a 5 rapid-acting antidepressant, wherein the method comprises: monitoring slow neural oscillations from the cortex of the brain of a subject to be administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring, administering to the subject in need thereof one or more rapid-acting antide10 pressant(s), monitoring slow neural oscillations from the cortex of the brain of the subject administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring, and determining a therapeutic efficacy of said rapid-acting antidepressant(s) based on fluctuations (e.g. dynamic fluctuations) on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) after the administration under the influence of said rapid-acting antidepressant(s) in said subject. Still further, the present invention relates to a rapid-acting antidepressant for use in 20 treating a subject having a nervous system disorder associated with compromised plasticity, wherein slow neural oscillations are monitored from the cortex of the brain of a subject to be administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring, one or more rapid-acting antidepressant(s) are to be administered to the subject in need thereof, slow neural oscillations are monitored from the cortex of the brain of the subject administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring, and a therapeutic efficacy of said rapid-acting antidepressant(s) is determined based on fluctuations (e.g. dynamic fluctuations) on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) after the administration under the influence of said rapid-acting antidepressant(s) in said subject. And still further, the present invention relates to a method for determining concurrent TrkB activation and ΟδΚβ inhibition (e.g. indirectly), wherein the method comprises 20176142 prh 21 -12- 2017 monitoring slow neural oscillations from the cortex of the brain of a subject by electrophysiological monitoring, wherein optionally antidepressant-induced TrkB activation and ΟδΚβ inhibition is indirectly determined when the electrophysiological monitoring reveals more slow oscillations in the I phase compared to the E phase. Furthermore, optionally it is possible to determine TrkB and ΟδΚβ signaling from the brain tissue using molecular biology methods (e.g. assaying the kinase activity or posttranslational modification that alter the activity state of given protein). And still furthermore, the present invention relates to a method for determining concurrent TrkB activation and ΟδΚβ inhibition (e.g. indirectly) by monitoring a sedative state of said subject. Other objects, details and advantages ofthe present invention will become apparent from the following drawings, detailed description and examples. BRIEF DEBCRIPTION OF THE DRAWINGB Figure 1 reveals that rapid-acting antidepressants facilitate cortical excitability that evokes a transient rebound emergence of slow EEG oscillations during which TrkB and ΟδΚ3β signaling becomes regulated. (A) Biological markers implicated in activity-dependent neuronal firing and antidepressant effects (c-fos, arc, bdnf, zif-268, homer-1 A, egr-2, mkp-1 and synapsin mRNA) are up-regulated 1-hour after 60 min N2O (50%) treatment while phosphorylation of TrkBY816 (indicate increased activity), ΟδΚ3βδ9 (indicate reduced activity) and p70B6kT421/424 (indicate increased activity) remain unaltered. (B) Biological markers implicated in activity-dependent neuronal firing (p-MAPKT202/Y204 and c-fos mRNA) are up-regulated during N2O (50%) administration while phosphorylation of TrkBY816, GδK3βS9and p70B6kT421/424 remain unaltered. (C) c-fos, arc and bdnfmRNAs levels are up-regulated to the same magnitude by 2-hour continuous N2O (50%) and 1-hour N2O (50%) followed by an hour washout period. (D) Representative time frequency EEG spectrogram and power of major EEG oscillations immediately before, during and after N2O (50%) administration. Blow-wave EEG oscillations (delta, theta) transiently emerge upon gas withdrawal. (E) Rebound slow-wave delta EEG oscillations after discontinuation of 75% N2O treatment. (F) Phosphorylation levels of TrkBY816, ΟδΚ3βδ9 and p70B6kT421/424 are increased at 5-minute post-^O exposure (50-75%). (G) Bubanesthetic dose of 20176142 prh 21 -12- 2017 ketamine (10 mg/kg, i.p.) evokes rebound slow-wave delta EEG oscillations gradually and only after the drug-induced high gamma oscillations have subsided. (H) Flurothyl-induced seizures evokes rebound emergence of slow-wave EEG oscillations. Levels of p-TrkBY816, p-GSK33S9and p70S6kT421/424 are increased at 15 min 5 after withdrawal of flurothyl. Data are means ± S.E.M. *<0.05, **<0.01, ***<0.005. Figure 2 reveals that sedative-anesthetic doses of ketamine regulate TrkB and ΟδΚ3β signaling while subanesthetic ketamine and c/s-6-hydroxynorketamine has negligible acute effects on these molecular events. (A) Phosphorylation of TrkBY816, 10 GSK33S9 and p70S6kT421/424 in the adult mouse medial prefrontal cortex 30 min after an i.p. injection of saline (SAL), c/s-6-hydroxynorketamine (HNK, 20 mg/kg) or ketamine (KET, 10 mg/kg, 100 mg/kg). (B) Effects of KET and 6,6-dideuteroketamine (d-KET, 100 mg/kg, i.p.; 30min) on p-TrkBY816, p-GSK33S9 and p-p70S6kT421/424. (C) Representative time frequency EEG spectrograms immediately before and during 15 HNK and KET treatment. (D) Power of major EEG oscillations during HNK and KET treatment. Sedative-anesthetic dose of KET increase most EEG oscillations including slow-wave delta and theta and gamma oscillations, while subanesthetic KET and HNK produce more subtle effects. (E) Amphetamine, a pharmacological stimulant, produces no acute effects on TrkB and GSK33 signaling. Data are means ± 20 S.E.M. *<0.05, **<0.01, ***<0.005. Figure 3 further confirms the dose-dependent effects of ketamine on TrkB and GSK33 signaling. (A) Phosphorylation of TrkBY816, GSK33S9 and p70S6kT421/424 in the mouse medial prefrontal cortex 30-minutes after an acute i.p. injection of keta25 mine (10 mg/kg, 50 mg/kg, 200 mg/kg; i.p.). (B) Phosphorylation of TrkBY816, GSK33S9 and p70S6kT421/424 in the adult mouse medial prefrontal cortex 3-minutes after an acute i.p. injection of high dose of ketamine (200 mg/kg; i.p.). Data are means ± S.E.M. *<0.05, **<0.01. Figure 4 further reveals the dose-dependent acute effects of ketamine on slow EEG oscillations. Power of major EEG oscillations during 30-minute ketamine (1,7.5, 10, 50 mg/kg, i.p.) treatment. Data are means ± S.E.M. Figure 5 reveals the effects of intermittent (i.e. repeated) nitrous oxide (N2O, 75%) 35 treatment on EEG. (A) Power of beta, gamma, theta and alpha oscillations in male mice before, during and after N2O. Note the emergence of slow-wave theta EEG oscillations upon gas withdrawal. (B) Power of major EEG oscillations in female 20176142 prh 21 -12- 2017 mice before, during and after N2O treatment. Note the emergence of slow-wave delta and theta EEG oscillations upon gas withdrawal. Data are means ± S.E.M. Figure 6 reveals increased phosphorylation of TrkB, ΟδΚ3β and p70S6k after with5 drawal from 65% N2O. Phosphorylation of TrkBY816, GSK33S9 and p70S6kT421/424 in the mouse medial prefrontal cortex at 15-minutes after discontinuing N2O (65%, 20 min). Data are means ± S.E.M. *<0.05, **<0.01. Figure 7 reveals gradual rebound emergence of slow EEG oscillations (1-4 Hz) after 10 subanesthetic dose of ketamine (7.5 mg/kg, i.p.) in female mice. Note that slow EEG oscillations emerge after the acute effects of ketamine on (high) gamma oscillations have subsided. Figure 8 reveals that direct facilitation of slow-wave EEG oscillations (delta, theta) 15 and “antidepressant-like” phosphorylation responses in TrkB and GSK33 under the influence of hypnotic-sedative drug medetomidine is not translated into behavioral changes associated with antidepressant responses. (A) Representative time frequency EEG spectrograms and power of major EEG oscillations during 30-minute saline and medetomidine (0.3 mg/kg, i.p.) treatment. (B) A low dose of medetomi20 dine (0.05 mg/kg, i.p.) rapidly increases phosphorylation of TrkBY816, GSK33S9 and p70S6kT421/424, while reduces phosphorylation of MAPKT202/Y204 (indicates reduced glutamatergic firing), in the mouse medial prefrontal cortex. (C) Dose-dependent effects of ketamine on phospho-MAPKT202/Y204. (D) Number of escape failures before and 24 hours after subanesthetic ketamine (15 mg/kg, i.p.) or medetomidine 25 (0.05 mg/kg, i.p.) in the learned helplessness paradigm. Data are means ± S.E.M. *<0.05, **<0.01, ***<0.005. Figure 9 reveals the acute effects of hypnotic-sedative drug gaboxadol (THIP) on EEG and TrkB signaling. (A) Phosphorylation of TrkBY816 and p70S6kT421/424 in the 30 adult mouse medial prefrontal cortex 30 min after an acute i.p. injection of gaboxadol (10 mg/kg; i.p.) or saline (SAL). (B) Power of major EEG oscillations during 30 min gaboxadol treatment. Data are means ± S.E.M. *<0.05, **<0.01. Figure 10 reveals the effects of tricyclic drug imipramine (an antidepressant that 35 alleviates depression very slowly) slow EEG oscillations and ΟδΚ3β phosphorylation. (A) Phosphorylation of TrkBY816, p70S6kT421/424 and ΟδΚ3βδ9 in the adult mouse medial prefrontal cortex 30 min after an acute i.p. injection of imipramine (50 20176142 prh 21 -12- 2017 mg/kg; i.p.) or saline (SAL). (B) Power of major EEG oscillations during 30 min gaboxadol treatment. Data are means ± S.E.M. **<0.01, ****<0.001. Figure 11 reveals the acute effects of medetomidine on immediate early gene ex5 pression. Levels of c-fos, arc, bdnf, homerla and zif-268 mRNA in the adult mouse medial prefrontal cortex remain unaltered 2 hours after an acute i.p. injection of medetomidine (0.3 mg/kg; i.p.) or saline. Data are means ± S.E.M. Figure 12 reveals the acute effects of medetomidine on EEG. Power of major EEG 10 oscillations during 30 min medetomidine treatment. Data are means ± S.E.M. Figure 13 shows the essential time-lapsed interplay between “excitation” (E phase) and “inhibition” (I phase) caused by rapid-acting antidepressants. Rapid-acting antidepressants produce cortical excitability that evokes a homeostatic emergence of 15 slow neural oscillations, during which molecular events intimately implicated with rapid antidepressant effects become altered: activation of TrkB receptor and inhibition of GSK33 (glycogen synthase kinase 3β). Such evoked homeostatic brain responses beneficial against depression can be rapidly produced and reproduced and controlled with interventions capable of producing transient cortical excitability. Mon20 itoring of the time-lapsed emergence of slow wave neuronal network oscillations before and during the treatment(s) can be utilized to control and monitor antidepressant efficacy. Figure 14 illustrates three example schemes (in a time line) enabled by the present 25 invention. Scheme 1 describes a method for determining a therapeutic efficacy of a rapid acting antidepressant by monitoring slow neural oscillations. Desired alterations of slow neural oscillations reveal the presence of therapeutic effects (e.g. rebound oscillations or more slow neural oscillations in the I phase compared to the E phase). Schemes 2 and 3 describe a real-time method for optimizing rapid acting 30 antidepressant treatment by monitoring slow neural oscillations. If a desired response is not achieved with a rapid acting antidepressant treatment said treatment may be e.g. repeated or modified or replaced with another rapid acting antidepressant in order to arrive at a desired or improved outcome (e.g. more slow neural oscillations in the I phase compared to the E phase). Schemes 1-3 are also appli35 cable e.g. for methods of screening novel rapid acting antidepressants or combinations thereof. 20176142 prh 21 -12- 2017 DETAILED DESCRIPTION OF THE INVENTION One object of the present invention is to provide a method for determining the therapeutic efficacy of a rapid-acting antidepressant. As used herein “rapid-acting anti5 depressant” refers to is a type of antidepressant which improves symptoms of depression quickly, within minutes to hours. Rapid-acting antidepressants are a distinct group of antidepressants compared to conventional antidepressants, which require weeks of administration for their therapeutic (e.g. antidepressant) effects to manifest. In one embodiment of the invention the rapid-acting antidepressant is a 10 pharmacological compound that has one or more of the following properties: NMDAR blockade (e.g. NMDA-R antagonists, ketamine, N2O) and/or GABAa-R blockade (e.g. GABAa-R antagonists, flurothyl) and/or GABAa-R positive allosteric modulation (e.g. gamma-hydroxybutyrate) and/or GHB-Ragonism (gamma-hydroxybutyrate, 3hydroxycyclopent-1-enecarboxylic acid (HOCPCA)) and/or AMPA-R positive allo15 steric modulation (e.g. positive allosteric modulators of the AMPA-R, hydroxynorketamine) and/or 5-HT2A-R agonism (e.g. psilocybin) and/or alfa2-R antagonism (e.g. atipamezole) and/or antimuscarinic (e.g. scopolamine) and/or up-regulate immediate-early genes and/or produce seizures and/or evoke glutamate release; or any related pharmaceutical or any combination thereof. In one embodiment of the inven20 tion the rapid-acting antidepressant is a pharmacological compound selected from the group consisting of: NMDA-R antagonist (e.g. NMDA-R antagonists, ketamine, N2O), GABAa-R antagonist (e.g. GABAa-R antagonists, flurothyl), GABAa-R positive allosteric modulator (e.g. gamma-hydroxybutyrate), GHB-R agonist (gamma-hydroxybutyrate, 3-hydroxycyclopent-1-enecarboxylicacid (HOCPCA)), AMPA-R pos25 itive allosteric modulator (e.g. positive allosteric modulators of the AMPA-R, hydroxynorketamine), 5-HT2A-R agonist (e.g. psilocybin), alfa2-R antagonist (e.g. atipamezole), and antimuscarinic (e.g. scopolamine), and any combination thereof. In one embodiment of the invention the rapid-acting antidepressant may be any pharmaceutical regulating excitation (i.e. E phase) with favorable kinetics (e.g. half30 life (ti/2): 1 s - 4 hours). In a further embodiment the rapid-acting antidepressant(s) is(are) a non-pharmacological antidepressant selected from the group consisting of sleep deprivation, electroconvulsive therapy (ECT), (repetitive) transcranial magnetic stimulation (TMS), transcranial direct current stimulation (tDCS), vagal nerve stimulation, photic stimulation, direct current stimulation, hyperthermia, hypother35 mia, cortical cooling, or any related non-pharmacological method, or any combination thereof. 20176142 prh 21 -12- 2017 Rapid-acting antidepressants of one type may be utilized in the present invention but alternatively two or more different types of rapid-acting antidepressants may be combined for the method of the present invention. In one specific embodiment the rapid-acting antidepressants are combined with other pharmaceuticals (e.g. one or 5 more rapid-acting or conventional antidepressants, or any other pharmaceutical(s)) or non-pharmaceutical treatments. In a specific embodiment the rapid-acting antidepressants are a combination of one or more pharmacological rapid-acting antidepressants and one or more non-pharmacological rapid-acting antidepressants (e.g. selected from the groups of pharmacological and non-pharmacological rapid-acting 10 antidepressants listed in the preceding paragraph). In the present invention slow neural oscillations are monitored from the cortex of the brain of a subject administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring. Neural oscillation is rhythmic or repetitive neural 15 activity in the nervous system. Oscillatory activity can be driven either by mechanisms within individual neurons or by interactions between neurons. Synchronized activity of large numbers of neurons can give rise to macroscopic oscillations, which can be observed by electrophysiological monitoring including but not limited to electroencephalogram (EEG) and/or magnetoencephalography (MEG). The interaction 20 between neurons can give rise to oscillations at a different frequency than the firing frequency of individual neurons. Oscillatory activity may respond to pharmaceuticals or non-pharmaceutical treatments e.g. by increases or decreases in frequency and/or amplitude, or show a temporary interruption. Neurons may change the frequency at which they oscillate. In one embodiment of the invention “slow neural 25 oscillations” refer to oscillations that have their frequency range between 1 - 6 Hz (delta, low theta). In the present invention slow neural oscillations are monitored from the cortex of the brain. “The cortex of the brain” refers to the cerebral cortex, the most anterior brain 30 region comprising an outer zone of neural tissue called gray matter, which contains neuronal cell bodies. As used herein “electrophysiological monitoring” refers to any monitoring of the presence, absence, amount or changes of any electrophysiological character (e.g. 35 slow neural oscillations) of a subject or any part thereof, e.g. in vivo, ex vivo or in vitro. In one embodiment of the invention the electrophysiological monitoring is EEG and/or MEG and/or other mean. EEG is an electrophysiological monitoring method 20176142 prh 21 -12- 2017 to record electrical activity of the brain. EEG is typically a noninvasive method, wherein the electrodes are placed along the scalp, but invasive EEG (intracranial EEG, iEEG) may also be utilized for the present invention. EEG measures voltage fluctuations resulting from ionic current within the neurons of the brain. The type of 5 neural oscillations can be observed in EEG signals in the frequency domain. Magnetoencephalography (MEG) is a functional neuroimaging technique for mapping brain activity by recording magnetic fields produced by electrical currents occurring naturally in the brain, using very sensitive magnetometers. Brain thermo- and energy regulations are implicated in antidepressant effects and generation of slow neural oscillations. Brain oscillatory rhythms are also regulated in a circadian manner and through homeostatic control mechanisms. Notably, slowwave delta oscillations (0.5-4 Hz) are characteristic features of non-REM deep sleep, sedation and drowsiness. The therapeutic efficacy of a rapid-acting antidepressant(s) utilized in the present invention is determined based on temporal fluctuations on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) after the administration under the influence of said rapid-acting antidepressant(s) in 20 a subject. Most importantly, the ability of the treatment to generate sufficient but transient “E phase” determines the rebound emergence of “I phase”. That said, a treatment that directly regulates “I phase” without preceding Έ phase” is not considered therapeutic. The “I phase” can be readily monitored by quantifying slow neural oscillations. Moreover, the emergence of rebound slow neural oscillations indi25 rectly monitor also the preceding Έ phase”. Slow neural oscillations remain unaltered or may reduce during Έ phase” compared to the period of prior applying any treatment (e.g. baseline). “E phase” may also be monitored by motor evoked potentials and the ability of any putative rapid-acting antidepressant to have properties required to generate sufficient Έ phase” can be predetermined in preclinical exper30 iments by investigating its effects on markers implicated in cortical excitation. For some specific treatments (e.g. ketamine), transient emergence of high gamma oscillations indicates ongoing Έ phase”. In one embodiment of the invention differences of slow neural oscillations before 35 and after administration of a rapid-acting antidepressant (e.g. decreased or no slow neural oscillations during E phase and increased slow neural oscillations during I phase; increased slow neural oscillations during E phase and decreased or no slow 20176142 prh 21 -12- 2017 neural oscillations during I phase), are used for determining the therapeutic efficacy or predicting the outcome of the therapy in a subject. In a specific embodiment differences of slow neural oscillations before administration of a rapid-acting antidepressant and after administration of said rapid-acting antidepressant during E phase 5 (e.g. decreased or no slow neural oscillations compared to slow neural oscillations before administration) and during I phase (e.g. increased slow neural oscillations compared to E-phase) are used for determining the therapeutic efficacy or predicting the outcome of the therapy in a subject. In one embodiment of the invention the electrophysiological monitoring revealing more slow oscillations in the I phase compared to the E phase indicates the therapeutic efficacy or good outcome of the rapid-acting antidepressant. On the other hand in one embodiment the electrophysiological monitoring revealing less slow neural oscillations in the I phase compared to the E phase, or no slow oscillations 15 in the I phase, or no slow oscillations in the I and E phases, indicates lack of therapeutic efficacy, poor therapeutic efficacy or poor outcome of the rapid-acting antidepressant. As used herein “more slow neural oscillations” refers to more slow neural oscillations measured by cumulative amount of high-amplitude slow neural oscillations. As used herein “less slow oscillations” refers to less slow oscillations meas20 ured by cumulative amount of high-amplitude slow neural oscillations. In a very specific embodiment the electrophysiological monitoring revealing at least 5%, 10%, 15%, or more (e.g. at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) slow oscillations in the I phase compared to the E phase indicates the therapeutic efficacy or outcome of the rapid-acting anti25 depressant. In the present invention the presence and/or absence and/or amount of slow neural oscillations may be used for indicating the therapeutic efficacy of the rapid-acting antidepressant. The specific properties and effects of a given rapid-acting antidepressant treatment 30 determines the duration of the Έ phase”. As for some specific treatments the Έ phase” may last only 1-30 seconds (e.g. flurothyl, ECT), although more sustained (1 min - 120 min) Έ phase” may be considered safer and more efficient (e.g. ketamine, nitrous oxide). In one embodiment of the invention the duration of the E phase is 1 second - 2 hours. In one embodiment of the invention the duration of the I phase 35 is 5 min - 1 hour. In a further embodiment of the invention the duration of the combination of E and I phases is 5 min - 3 hours. In one embodiment of the invention duration of the E phase is about 30 seconds that produces rebound emergence of 20176142 prh 21 -12- 2017 “I phase” lasting about 10-30 min. In another embodiment of the invention the duration of the E phase is about 5 seconds that produces rebound emergence of “I phase” lasting about 5-10 min. In a very specific embodiment of the invention concurrent (i.e. simultaneous) emergence of E phase and I phase indicates therapeutic efficacy or good outcome of the therapy of the rapid-acting antidepressant(s) in a subject. In some embodiments of the present invention, the slow neural oscillations or wave10 forms thereof or lack of slow neural oscillations in the EEG segment representing the period when a subject is under the influence of a rapid-acting antidepressant are compared to reference slow neural oscillations or waveforms thereof or lack of slow neural oscillations. A reference waveform is the waveform in the EEG segment before administration of the rapid-acting antidepressant. In a very specific embodiment 15 it is possible to classify slow neural oscillations or waveforms (e.g. as either slow waves or not slow waves) via numerical outputs, which are generated based on slow neural oscillations or waveforms of a subject under the influence of a rapid-acting antidepressant and a reference waveform. As used herein “under the influence of a rapid-acting antidepressant(s)” refers to a time-period when a rapid-acting antidepressant has direct pharmacological or physiological effects on a subject. Said time-period varies depending on the rapid-acting antidepressant(s) (e.g. ti/2) and may be selected e.g. from prior art publications or based on the common general knowledge of a skilled artisan. Examples of suitable 25 periods include but are not limited to e.g. about 1 second - 3 hours for nitrous oxide and about 5 min -120 min for ketamine. As used herein “a therapeutic efficacy” refers to an ability to ameliorate any harmful effects of the nervous system disorder associated with compromised plasticity, such 30 as including but not limited to depression, sleepiness, sleep problems, feeling anxious, mood swings, psychosis, hallucinations, weight gain, suicidal thoughts, disturbing thoughts, feelings or dreams, mental or physical distress to trauma-related cues, attempts to avoid trauma-related cues, alterations in how a person thinks and feels, neurodegeneration, addiction and brain trauma. In one embodiment the therapeutic 35 efficacy is for nervous system disorder associated with compromised plasticity, e.g. a disorder is selected from the group consisting of depression, anxiety, addiction, 20176142 prh 21 -12- 2017 neurodegenerative disorder, brain trauma, post-traumatic stress disorder, and neuropathic pain. As used herein depression refers to any type of depression e.g. major depression, chronic depression (dysthymia), atypical depression, postpartum depression, bipolar depression (manic depression), seasonal depression (SAD), psychotic 5 depression and/or treatment-resistant depression. Anxiety or anxiety disorders are a group of mental disorders characterized by feelings of anxiety and fear. Neurodegenerative disorders are a group of conditions which primarily affect the neurons in the human brain. When neurons of the nervous system (including the brain and spinal cord) become damaged or die they cannot be replaced by the body. Exam10 pies of neurodegenerative diseases include Parkinson’s, Alzheimer’s, and Huntington’s disease. Neuropathic pain is pain caused by a damage or disease affecting the somatosensory nervous system. A therapeutic effect of administration of a rapid acting antidepressant may be as15 sessed by monitoring the slow neural oscillations and/or any other characteristics e.g. symptoms of a subject such as selected from the group consisting of, but not limited to, depression, sleepiness, sleep problems, feeling anxious, mood swings, psychosis, hallucinations, weight gain, suicidal thoughts, disturbing thoughts, feelings or dreams, mental or physical distress to trauma-related cues, attempts to avoid 20 trauma-related cues, alterations in how a person thinks and feels, neurodegeneration, addiction and brain trauma. Therapeutically effective amount of a rapid acting antidepressant refers to an amount with which the harmful effects of a nervous system disorder associated with 25 compromised plasticity, e.g. depression, anxiety, post-traumatic stress disorder, neurodegenerative disorder, neuropathic pain, or addiction, are, at a minimum, ameliorated. The effects of rapid acting antidepressants may be either short term or long term effects. “Treatment” or “treating” refers to administration of a rapid acting antidepressant for purposes which include not only complete cure but also prophylaxis, amelioration, or alleviation of disorders or symptoms related to nervous system disorder associated with compromised plasticity, e.g. a disorder is selected from the group consisting of depression, anxiety, post-traumatic stress disorder, neurodegenerative disor35 der, neuropathic pain, and addiction. In one embodiment of the invention the rapidacting antidepressant is or has been administered intravenously, intra-arterially, in17 20176142 prh 21 -12- 2017 tramuscularly, intranasally, by an oral administration or by inhalation. Any conventional method may be used for administration. A person skilled in the art knows how and when to administer a rapid-acting antidepressant, depending e.g. on the type of the rapid-acting antidepressant and formulation thereof as well as a subject and 5 symptoms or disease of said subject. In one specific embodiment a rapid-acting antidepressant is a pharmaceutical composition comprising at least a therapeutically effective agent. In addition, a pharmaceutical composition may also comprise any other therapeutically effective agents, any other agents, such as a pharmaceutically acceptable solvent, diluent, carrier, buffer, excipient, adjuvant, antiseptic, fill10 ing, stabilizing or thickening agent, and/or any components normally found in corresponding products. The pharmaceutical composition may be in any form, such as in a solid, semisolid or liquid form, suitable for administration. A formulation can be selected from a group consisting of, but not limited to, solutions, emulsions, suspensions, spray, tablets, pellets and capsules. The pharmaceutical compositions may 15 be produced by any conventional processes known in the art. In a specific embodiment a rapid-acting antidepressant is administered or has been administered on the same day when the therapeutic efficacy is determined. In one embodiment monitoring of the slow neural oscillations or determination of the ther20 apeutic efficacy is repeated once or twice or several times after the subject has further been administered with the rapid-acting antidepressant for the second time, third time or several times e.g. during the same day as the first administration, respectively, or after the subject has further been administered with another rapidacting antidepressant. Additionally, the administration of a rapid-acting antidepressant can be combined to the administration of other therapeutic agents. The administration can be simultaneous, separate or sequential. The administration of a rapid-acting antidepressant can also be combined to other forms of therapy, such as psychotherapy, and may 30 be more effective than either one alone. In one embodiment of the invention a rapidacting antidepressant is utilized as the only therapeutically active agent. In a very specific embodiment a therapeutic state of the brain is obtained by the method of the present invention, wherein the cortex of the brain of a subject admin35 istered with a rapid acting antidepressant is monitored. A therapeutic state of the brain refers to a state, which causes, enables or augments therapeutic effects e.g. amelioration of the symptoms of a subject. On the other hand, a therapeutic state of 20176142 prh 21 -12- 2017 the brain may also refer to a therapeutically optimal state of the brain e.g. for psychotherapy to take its best effects. In such a case administration of a rapid-acting antidepressant does not necessarily cause amelioration of the symptoms in a subject by itself but enables optimal effects of rehabilitation. Indeed, the present inven5 tion enables personalized treatment of a subject, e.g. when combined with any nonpharmaceutical therapy such as psychotherapy. In one embodiment the method of the present invention further comprises monitoring neurophysiological data, behavioral data, respiratory data, blood flow data, car10 diac data, galvanic skin response data, data on biochemical marker(s) (e.g. markers from the blood, serum, urine, brain) or any combination thereof, specifically after the administration under the influence of said rapid-acting antidepressant(s) in said subject. In a further embodiment the behavioral data is selected from the group consisting of data of a questionnaire study, data of the Hamilton rating scale for depression, 15 data of the beck depression inventory, and data of the suicide behaviors questionnaire. In a specific embodiment no further monitoring is needed, i.e. e.g. the method comprises monitoring slow neural oscillations from the cortex of the brain of a subject administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring and no further monitoring is needed, or the method comprises 20 monitoring slow neural oscillations from the cortex of the brain of a subject administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring and further comprises monitoring neurophysiological data, behavioral data, respiratory data, blood flow data, cardiac data, galvanic skin response data, data on biochemical marker(s) or any combination thereof and no further monitoring is 25 needed. Surprisingly the present invention enables determining TrkB and GSKp signaling alterations indirectly. As used herein determining TrkB and ΟδΚβ signaling refers to determining the presence, absence and/or amount of signaling. Indeed, the re30 suits of the present disclosure are able to reveal an association between TrkB and ΟδΚβ signaling and slow neural oscillations, e.g. more slow EEG oscillations predicts on-going TrkB activation and ΟδΚ3β inhibition in the brain. As used herein “indirectly” refers to a situation wherein TrkB and 6δΚβ signaling are indirectly determined by monitoring slow neural oscillations, potentiated by the found association 35 between TrkB and ΟδΚβ signaling and slow neural oscillations. In a very specific embodiment TrkB and 6δΚβ signaling are indirectly determined by monitoring slow neural oscillations or the sedative state of the subject. As used herein “a sedative 20176142 prh 21 -12- 2017 state” refers to a state of a subject with reduced irritability or excitement and said sedative state can be monitored e.g. using specific scales. Examples of such scales, which can also be used in the present invention include MSAT (Minnesota Sedation Assessment Tool), IIMSS (University of Michigan Sedation Scale), the Ramsay 5 Scale (Ramsay, et al. 1974) and/or the RASS (Richmond Agitation-Sedation Scale). The continuum of sedation may be defined e.g. as follows (American society of Anesthesiologists): minimal sedation (normal response to verbal stimuli), moderate sedation or conscious sedation (purposeful response to verbal/tactile stimulation), deep sedation (purposeful response to repeated or painful stimulation), general an10 esthesia (unarousable even with painful stimulus). In some context deep sedation may also be considered as a part of the spectrum of general anesthesia. In the present study (see examples section of the disclosure) it was found that N2O, a NMDA-R antagonist and a rapid-acting antidepressant, produce rebound (i.e. after 15 drug withdrawal) slow EEG oscillations in succession to the facilitation of cortical excitability during gas administration. Most importantly, ongoing slow EEG oscillations co-associate with increased activation of TrkB and inhibition of ΟδΚ3β. The intriguing positive correlation between these molecular events coupled with rapid antidepressant effects and slow EEG oscillations - neural oscillations characteristic 20 for deep sleep - was further confirmed with hypnotic-sedative agents. Most importantly, the present study further demonstrates that TrkB activation or GSK3 inhibition per se is insufficient in producing antidepressant effects. Instead consecutive regulation of cortical excitability and regulation of TrkB and ΟδΚ3β during the rebound slow EEG oscillations is shared neurobiological phenomenon for interven25 tions that can bring rapid antidepressant responses in humans. In particular, the ability of a drug or non-pharmacological procedure to directly augment slow neural oscillations, without the preceding cortical excitability and under the direct influence of said manipulation, does not determine its antidepressant effects. More specifically, the data of the present disclosure demonstrate that slow neural oscillations - readily and safely captured by the EEG - predict ongoing TrkB activation and ΟδΚ3β inhibition in the brain. First, ketamine dose-dependently regulates activation TrkB (tyrosine phosphorylation I autophosphorylation) and ΟδΚ3β inhibition (phosphorylation into the inhibitory sehne-9 residue); most prominent effects 35 are evident at doses producing anesthesia and prominent slow neural oscillations. Notably, subanesthetic, rather than sedative-anesthetic, doses of ketamine are 20176142 prh 21 -12- 2017 commonly considered as doses relevant with antidepressant effects. Second, hypnotic-sedative agents that specifically increase slow neural EEG readily recapitulate the effects of ketamine (sedative-anesthetic doses) on TrkB and ΟδΚ3β signaling. The ability of classical antidepressants, such as tricyclic antidepressants, to acutely 5 regulate TrkB and ΟδΚ3β signaling is also associated with the emergence of slow wave EEG. Most convincingly, TrkB and ΟδΚ3β signaling remain unaltered during N2O administration when slow neural activity is slightly reduced. Phosphorylation of TrkB and 6δΚ3β emerge gradually only after discontinuation of N2O and this is directly associated with a rebound increase in slow EEG oscillations. Interestingly, 10 whereas N2O readily increases activity-dependent immediate early genes it's effects on slow oscillations (and TrkB and ΟδΚ3β signaling) emerge as a response in the brain upon discontinuation of the gas flow. As used herein TrkB i.e. tropomyosin receptor kinase B (also called as neurotrophic receptor tyrosine kinase 2, NTRK2) refers to the high affinity catalytic receptor for neurotrophins, which are small pro15 tein growth factors that induce the survival, maintenance, differentiation of distinct neuronal populations. Borne neurotrophins, in particular BDNF (brain-derived neurotrophic factor), also importantly regulates neuronal and synaptic plasticity. Several pharmaceuticals activate TrkB receptors (e.g. antidepressants) and thereby promote neuronal plasticity and provide neuroprotection. The neurotrophins that acti20 vate TrkB are BDNF (Brain Derived Neurotrophic Factor), neurotrophin-4 (NT-4), and neurotrophin-3 (NT-3). Human TrkB has e.g. Ensembl accession number ENSG00000148053 and mouse TrkB has e.g. Ensembl accession number ENSMUSG00000055254. Tyrosine phosphorylation of TrkB (into tyrosine Y515, Y705/6 and Y816) can be used as indirect measures of TrkB activity. As used herein ΟδΚ3β is a beta isoform of a glycogen synthase kinase-3 (GSK-3), which is a proline-directed serine threonine kinase that was initially identified as a phosphorylating and an inactivating agent of glycogen synthase. GSK3B is involved in energy metabolism, neuronal cell development, and body pattern formation. 30 ΟδΚ3β has an EC number EC 2.7.11.1 ((protein-serine/threonine kinase) inhibitor that interferes with the action of tau-protein kinase inhibitor (EC 2.7.11.26)). Phosphorylation of ΟδΚ3β into the serine-9 residue is associated with reduced ΟδΚ3β activity. Inhibition of ΟδΚ3β kinase activity is implicated into the therapeutic effects of several distinct pharmaceuticals (e.g. antimanic lithium, rapid-acting antidepres35 sant ketamine). 20176142 prh 21 -12- 2017 Increased glutamatergic signaling and cortical excitability are strongly connected with the immediate central actions of the most efficient and rapid-acting antidepressant therapies, as experimentally evidenced by the activation of mitogen-activated protein kinase (MARK) and increased expression of activity-dependent immediate 5 early genes (lEGs; e.g. c-fos, arc, bdnf) (de Bartolomeis et al, 2013 Prog. Neuropsychopharmacol. Biol. Psychiatry 46, 1-12; Cirelli et al, 1995, J. Sleep Res. 4, 92106; Hansen et al, 2007, Cell. Mol. Neurobiol. 27, 585-594; Larsen et al, 2005, Brain Res. 1064, 161-165; Li et al, 2010, Science 329, 959-964; Nibuya et al, 1995, J. Neurosci. Off. J. Soc. Neurosci. 15, 7539-7547; Taishi et al, 2001, Am. J. Physiol. Regul. Integr. Comp. Physiol. 281, R839-845). As used herein Arc refers to a gene encoding the activity regulated cytoskeleton associated protein (e.g. Ensembl accession numbers ENSG00000198576 (human) and ENSMUSG00000022602 (mouse)). Arc is a member of the immediate early 15 gene (IEG) family, a rapidly activated class of genes functionally defined by their ability to be transcribed in the presence of protein synthesis inhibitors. Arc is widely considered to be an important protein in neurobiology because of its activity regulation, localization, and utility as a marker for plastic changes in the brain. As used herein Bdnf refers to a gene encoding brain derived neurotrophic factor (BDNF) (e.g. Ensembl accession numbers ENSG00000176697 (human) and ENSMUSG00000048482 (mouse)). BDNF acts on certain neurons of the central nervous system and the peripheral nervous system, helping to support the survival of existing neurons, and encourage the growth and differentiation of new neurons 25 and synapses. In one very specific embodiment of the invention determination of the therapeutic efficacy of one or more rapid-acting antidepressant is carried out in real-time. Real time methods enable efficient, user friendly and safe personalized therapies as well 30 as opportunities to optimize the treatment or dosing of rapid acting antidepressants quickly. In a specific embodiment of the invention monitoring of slow neural oscillations is carried out continuously during the treatment session e.g. before the treatment, immediately after administration of a rapid acting antidepressant, during the influence of said rapid acting antidepressant and after the acute pharmacological 35 effects of said rapid acting antidepressant has subsided. As used herein continuously refers to following up changes of the slow neural oscillations in a non-stop way. Expression continuously is opposite to monitoring every now and then or 20176142 prh 21 -12- 2017 during a specific period of time. In another specific embodiment of the invention monitoring of slow neural oscillations is carried out one or several times (i.e. noncontinuously), e.g. during the E phase and I phase such as during specific periods of time of the E phase and I phase. One object of the present invention is to provide a real-time method of optimizing antidepressant treatment. In one embodiment of the invention optimizing the rapidacting antidepressant treatment is selected from the group consisting of i) continuing said treatment, ii) optimizing the dosing of said rapid-acting antidepressant or the 10 dosing of another rapid-acting antidepressant, iii) stopping the treatment and iv) combining said rapid-acting antidepressant treatment with another pharmaceutical such as another rapid-acting antidepressant. It is well known to a person skilled in the art that when a rapid-acting antidepressant has a desired effect, at least based on the results of monitoring slow neural oscillations, said treatment may be contin15 ued. However, when a rapid-acting antidepressant does not have a desired effect at least based on the slow neural oscillations, dosing of said rapid-acting antidepressant or the dosing of another rapid-acting antidepressant may be optimized for obtaining a desired effect. Alternatively, e.g. when a subject does not respond to a rapid-acting antidepressant said treatment may be stopped. A person skilled in the 20 art also knows when a desired effect could be obtained e.g. by combining the rapidacting antidepressant treatment with another pharmaceutical such as another rapidacting antidepressant. Real time monitoring and optimizing methods enable several types of optimizations within a reasonable period of time. The effective dose of a rapid-acting antidepressant depends on at least the rapidacting antidepressant in question, the subject in need of the treatment, the type of disease e.g. type of depression, and the level of the disease (e.g. depression). For intravenous ketamine, the dose may vary for example from about 0.4 mg/kg/h to about 1 mg/kg/h, specifically from about 0.4 mg/kg/h to about 0.8 mg/kg/h, and more 30 specifically from about 0.5 mg/kg/h to about 0.7 mg/kg/h. For intranasal ketamine, the dose may vary for example about 25-150 mg (fixed dose). For N2O the dose may vary for example from about 10% to about 75%, specifically from about 30% to about 75%. Under specific conditions, short intermittent exposure(s) of up to 100% N2O and 100% oxygen may be used. Pharmacokinetically fast rapid-acting antide35 pressant, such as N2O, may be administered for example from 1 to 20 times during the same treatment session. Same dosing principles may be applied for concomitant treatment with ketamine and N2O. A desired dosage can be administered in one or 20176142 prh 21 -12- 2017 more doses at suitable intervals to obtain the desired results. Only one administration of a rapid acting antidepressant may have a therapeutic effect, but specific embodiments of the invention require several administrations (e.g. 2-30) during the whole treatment period. The period between administrations may depend on e.g. 5 the patient and type of a disease. In one embodiment of the invention there is a time period of one minute to 24 hours, specifically 2 to 10 hours, between consecutive administrations of rapid acting antidepressants. In a further embodiment the brain state obtained by administering a rapid-acting 10 antidepressant is reproduced or optimized for inducing plasticity. The present invention may further be utilized for screening novel rapid-acting antidepressants or screening an optimal subject for a rapid-acting antidepressant treatment, wherein therapeutic efficacy of a pharmaceutical comprising a rapid-acting 15 antidepressant may be determined at least based on fluctuations on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) after the administration under the influence of said pharmaceutical in said subject. Screening of novel rapid-acting antidepressants in vivo may be carried out by any conventional method known in the art, e.g. in a way wherein a putative rapid20 acting antidepressant is administered to a subject (e.g. an animal or a human) one or several times and the therapeutic efficacy is determined as defined in the independent claims. Selecting an optimal subject or subjects for a rapid-acting antidepressant treatment enables personalized and effective treatments. In other words, subjects who most likely benefit from a specific antidepressant treatment will have 25 a normal treatment period, whereas subjects who most likely do not benefit from a specific treatment will receive another kind of treatment or a combination of treatments. Treatment methods are also within the scope of the present invention, and then one 30 or more rapid-acting antidepressants are administered to a subject in need thereof. In one embodiment of the invention the method of treating a subject with a rapidacting antidepressant further comprises optimizing the rapid-acting antidepressant treatment. “Optimizing the rapid-acting antidepressant treatment” may refer to any action, which results in a better therapeutic effect, e.g. including but not limited to 35 changing a dosing of an antidepressant, type of administration, the number of administrations, the antidepressant and a combination of pharmaceuticals. In one em24 20176142 prh 21 -12- 2017 bodiment of the invention the method of treating a subject with a rapid-acting antidepressant comprises optimizing the rapid-acting antidepressant treatment, wherein optimizing the rapid-acting antidepressant treatment is selected from the group consisting of i) continuing said treatment, ii) optimizing the dosing of said 5 rapid-acting antidepressant or the dosing of another rapid-acting antidepressant, iii) stopping the treatment and iv) combining said rapid-acting antidepressant treatment with another pharmaceutical such as another rapid-acting antidepressant. Before screening an optimal subject or classifying a subject as suitable for the ther10 apy or method for determining the therapeutic efficacy of the present invention, the clinician may for example study any symptoms or assay any disease markers of the subject. Based on the results deviating from the normal, the clinician may suggest a rapid-acting antidepressant treatment of the present invention for the subject. In one embodiment of the invention a subject is a human or an animal, a child, an adolescent or an adult. In one embodiment a subject is in a need of a treatment or administration of said rapid-acting antidepressant. Systems and means configured to detect or monitor slow neural oscillations in real 20 time and/or near real time and to be used in the methods of the present invention are also within the scope of the present invention. It will be obvious to a person skilled in the art that, as the technology advances, the inventive concept can be implemented in various ways. The invention and its em25 bodiments are not limited to the examples described below but may vary within the scope of the claims. EXAMPLES Materials and methods Animals Adult male and female C57BL/6JRccHsd mice (Harlan Laboratories, Venray, Netherland) were used. Animals were maintained in the animal facility of University of 35 Helsinki, Finland, under standard conditions (21 °C, 12-hour light-dark cycle) with free access to food and water. The experiments were carried out according to the 20176142 prh 21 -12- 2017 guidelines of the Society for Neuroscience and were approved by the County Administrative Board of Southern Finland (License: ESAVI/10527/04.10.07/2014). Pharmacological treatments Medical grade N2O (Livopan 50% N2O/O2 mix, Linde Healthcare; Niontix 100% N2O, Linde Healthcare). Medical grade oxygen (Conoxia 100% O2, Linde Healthcare) was mixed with 100% N2O to achieve >50 (-80%) N2O concentrations. Gas was administered into airtight Plexiglass chambers (14 cm x 25 cm x 9 cm) with a flow rate of 4-8 l/min. Oxygen or room air was administered for sham animals. To induce myoclonic seizures, 10% flurothyl liquid (in 95% ethanol; Sigma-Aldrich) were administered into the cotton pad placed inside the lid of an airtight Plexiglass chamber (13 cm x 13 cm x 13 cm) at the flow rate of 100 μΙ/min until the mice exhibited seizures. The lid was removed to terminate the seizure. Animals were eu15 thanized at indicated times (10-60 min) post-seizure. The following other drugs (and doses) were used: ketamine-HCI, 6,6-d2-ketamineHCI, medetomidine-HCI, dextroamphetamine-HCI, cis-6-hydroxynorketamine-HCI, imipramine-HCI, gaboxadol-HCl. These drugs were diluted in isotonic saline solution and injected i.p. with a final injection volume of 10 ml/kg. Western blotting and quantitative RT-PCR Animals were sacrificed at indicated times after the treatments by rapid cervical dislocation followed by decapitation. Bilateral medial prefrontal cortex (including prelimbic and infralimbic cortices) was rapidly dissected on a cooled dish and stored at 25 -80°C (Antila et al, 2017, Sei. Rep. 7, 7811; Rantamäki et al, 2007, Neuropsychopharmacol. Off. Pubi. Am. Coll. Neuropsychopharmacol. 32, 2152-2162). For western blotting the brain samples were homogenized in lysis buffer (137 mM NaCI, 20 mM Tris, 1% NP-40, 10% glycerol, 48 mM NaF, H2O, Complete inhibitor 30 mix (Roche), PhosStop (Roche)) (Rantamäki et al, 2007, Neuropsychopharmacol. Off. Pubi. Am. Coll. Neuropsychopharmacol. 32, 2152-2162). After ~15 min incubation on ice, samples were centrifuged (16000g, 15 min, +4°C) and the resulting supernatant collected for further analysis. Sample protein concentrations were measured using Bio-Rad DC protein assay (Bio-Rad Laboratories, Hercules, CA). 35 Samples (40-50 pg protein) were separated with SDS-PAGE under reducing and denaturing conditions and blotted to a PVDF (polyvinylidene difluoride) membrane (300 mA, 1 hour, 4°C). Membranes were incubated with the following primary antibodies (see (Antila et al, 2017)): anti-p-TrkB (#4168; 1:1000; Cell signaling technology (CST)), anti-TrkB (1:1000; #4603, CST), anti-Trk (sc-11; 1:1000; Santa Cruz Biotechnology (SCB); ), anti-p-CREB (#9191S; 1:1000; CST), anti-p-p70S6K 5 (#9204S; 1:1000; CST), anti-p-GSK33S9 (#9336; 1:1000; CST), anti-p-p44/42-MAPKThr202/Y204 (#9106 1:10Q0, CST), anti-GSK33 (#9315, 1:1000, CST), anti-p70S6K (#2708, 1:1000, CST) anti-p44/42-MAPK (#9102, 1:1000, CST) and anti-GAPDH (#2118, 1:10 000, CST). Further, the membranes were washed with TBS/0.1% Tween (TBST) and incubated with horseradish peroxidase conjugated secondary 10 antibodies (1:10000 in non-fat dry milk, 1 h at room temperature; Bio-Rad). After subsequent washes, secondary antibodies were visualized using enhanced chemiluminescence (ECL Plus, ThermoScientific, Vantaa, Finland) for detection by Biorad ChemiDoc MP camera (Bio-Rad Laboratories, Helsinki, Finland). For qPCR, total RNA of the sample was extracted using Thzol (Thermo Scientific) according to the manufacturer’s instructions and treated with DNAse I mix. mRNA was reverse transcribed using oligo (dT) primer and SuperScript III Reverse Transcriptase mix (Thermo Scientific). The amount of cDNA was quantified using realtime PCR. The primers used to amplify specific cDNA regions of the transcripts are 20 shown in Table 1. DNA amplification reactions were run in triplicate in the presence of Maxima SYBRGreen qPCR mix (Thermo Scientific). Second derivate values from each sample were obtained using the LightCycler 480 software (Roche). Relative quantification of template was performed as described previously using standard curve method, with cDNA data being normalized to the control Gapdh and β-actin 25 level. 20176142 prh 21 -12- 2017 Table 1. Primers used for quantitative RT-PCR. GeneForward primerReverse primerArcAAGTGC C G AG CTG AG ATG C (SEQ ID NO: 1)CGACCTGTGCAACCCI I I C (SEQ ID NO: 2)β-actinGGCTGTATTCCCCTCCATCG (SEQ ID NO: 3)CCAGTTGGTAACAATGCCATGT(SEQ ID NO: 4)Bdnf (exon IV)ACCGAAGTATGAAATAACCATAGTAAG (SEQ ID NO: 5)TG I I I AC I I I GACAAGTAGTGACTGAA(SEQ ID NO: 6)Bdnf (total)GAAGGCTGCAGGGGCATAGACAAA (SEQ ID NO: 7)TACACAGGAAGTGTCTATCCTTATG (SEQ ID NO: 8) cFosCGGG I I I CAACGCCGACTA (SEQ ID NO: 9)TTGGCACTAGAGACGGACAGA (SEQ ID NO: 10)Egr1GCCAAGGCCGTAGACAAAATC (SEQ ID NO: 11)CCACTCCGTTCATCTGGTCA(SEQ ID NO: 12)GapdhGGTGAAGGTCGGTGTGAACGG (SEQ ID NO: 13)CATGTAGTTGAGGTCAATGAAGGG (SEQ ID NO: 14)HomerlaGGCAAACACTGI I IATGGACTGG (SEQ ID NO: 15)GTAATTCAGTCAACTTGAGCAACC (SEQ ID NO: 16)Mkp1CTGC I I I GATCAACGTCTCG (SEQ ID NO: 17)AAGCTGAAGTTGGGGGAGAT (SEQ ID NO: 18)SynapsinACACCGACTGGGCAAAATA (SEQ ID NO: 19)GTCACAGAAGTTGTAGACAGAATG (SEQ ID NO: 20)Zif268 (egr-1)TCCTCTCCATCACATGCCTG (SEQ ID NO: 21)CACTCTGACACATGCTCCAG(SEQ ID NO: 22) 20176142 prh 21 -12- 2017 EEG recordings and data analysis For the implantation of electrodes, mice were anesthetized with isoflurane (3% induction, 1.5-2% maintenance). Lidocaine (10 mg/ml) was used as local anesthetic 5 and buprenorphine (0.1 mg/kg, s.c.) for postoperative care. Two epidural screw EEG (electroencephalogram) electrodes were placed above the fronto-parietal cortex. A further screw served as mounting support. Two silver wire electrodes were implanted in the nuchal muscles to monitor the EMG (electromyogram). After the surgery, mice were single-housed in Plexiglas boxes. After a recovery period of 5-7 10 days, animals were connected to flexible counterbalanced cables for EEG/EMG recording and habituated to recording cables for three days. Baseline EEG (10-15 min) recordings of awake animals were conducted prior the treatments. All injection treatments were conducted in the animal’s home cages dur15 ing light period. N2O treatment was delivered in homemade anesthesia boxes for indicated time periods with a flow rate of 8 l/min. The EEG and EMG signals were amplified (gain 5 or 10 K) and filtered (high pass: 0.3 Hz; low pass 100 Hz; notch filter) with a 16-channel AC amplifier (A-M System, 20 model 3500), sampled at 254 Hz or 70 Hz with 1401 unit (CED), and recorded using Spike2 (version 8.07, Cambridge Electronic Devices). The processing of the EEG data was obtained using Spike2 (version 8.07, Cambridge Electronic Devices). EEG power spectra were calculated within the 1-50 Hz frequency range by fast Fourier 20176142 prh 21 -12- 2017 transform (FFT = 256, Hanning window, 1.0 Hz resolution). Oscillation power in each bandwidth (delta=1-4 Hz; theta=4-7 Hz; alpha=7-12 Hz; beta=12-25 Hz; gamma low=25-40 Hz; gamma high=60-100 Hz) was computed in 30-300-sec epochs from spectrograms (FFT size: 1024 points) for each animal. Representative sonograms 5 were computed using a Hanning window with a block size of 512. Learned helplessness test Animals were placed in a shuttle box (Panlab LE100-26, LE900; Software: Bioseb Packwin) and let habituate for 3 min. On day 1, a pre-test was conducted consisting 10 of 140 randomly-paced (at 25, 30 or 35 s intervals) inescapable foot shocks (0.45mA, 20 s duration). The pre-test was repeated on day 2. On day 3, testing was conducted starting with 1 minute habituation and followed by 15 randomly-paced (at 25, 30 or 35 s intervals) escapable shocks (0,45 mA, 20 s duration). During testing, animals were able to interrupt the shock delivery/escape by crossing to another 15 chamber. If the animal failed to escape during the first 10 seconds of a test shock, the trial was considered as a failure. If more than 50 % of the 15 trials led to a failure, the animal was considered helpless. After testing, animals were injected (i.p.) with saline, ketamine (15 mg/kg) or medetomidine (0.05 mg/kg). Learned helplessness was re-evaluated 24 h post-injection. Screening of novel rapid acting antidepressants Any rapid acting antidepressant e.g. medical grade nitrous oxide (N2O) or subanesthetic ketamine is utilized as a positive control and hypnotic-sedative drug (e.g. medetomidine) utilized as a negative control when novel medicaments are screened 25 for therapeutic effects of rapid acting antidepressants in experimental animals (e.g. rodents). Test medicaments may be prescreened in in vitro settings for their ability to regulate glutamatergic excitation (e.g. immediate early gene expression, phosphorylation of MAPK) and neural oscillations. Animals, pharmacological treatments, EEG recordings and data analysis are carried out as described above. All medica30 ments having slow neural oscillation profiles resembling those of positive control are forwarded to further studies. Statistical analyses Depending on whether data were normally distributed or not, either parametric or 35 nonparametric tests were used for statistical evaluation. In case of more than two 20176142 prh 21 -12- 2017 groups, analysis of variance (ANOVA) was used. All statistical analyses were performed with the Prism 7 software from GraphPad (La Jolla, CA, USA). All tests were used two-sided; a P < 0.05 was considered significant. Human studies Human studies with rapid-acting antidepressants are carried out to confirm the results found in animal studies and to correlate EEG observations to clinical outcome (e.g. amelioration of depressive symptoms). After clinical assessment (e.g. symptoms), an EEG recording set-up will be installed for the subjects. EEG will be rec10 orded for 5-30 min at baseline after which the medicaments will be delivered to the subjects during continuous EEG recording. For N2O (50-65%) the EEG will be recorded during the gas flow (E phase) and upon gas withdrawal (I phase); and the treatments repeated for at least once during the same treatment session. For ketamine, the EEG will be recorded for 1-4 hours to estimate time-lapsed alterations in 15 EEG oscillations during the initial phase (E phase) and after the acute pharmacological effects have subsided (I phase). Clinical outcome of the treatments may be assessed at varying time-points post-treatments and correlated retrospectively to EEG analyses. Results Rapid-acting antidepressants facilitate cortical excitability that evokes a transient rebound emergence of slow EEG oscillations during which TrkB and GSK3P signaling becomes regulated The remarkable ability of ketamine, a dissociative anesthetic and a drug of abuse, to rapidly ameliorate depressive symptoms after only a single subanesthetic dose has stimulated great enthusiasm among scientists and clinicians (Aan Het Rot et al. 2012, Biol. Psychiatry. 72, 537-547; Berman etal. 2000, Biol. Psychiatry. 47, 35130 354). Reported response rates to ketamine are somewhat impressive, but many patients remain treatment-refractory (Aan Het Rot et al. 2012, Biol. Psychiatry. 72, 537-547). To this end, extensive research input has been put forward to uncover predictive efficacy markers and to nail down the precise pharmacological basis governing the antidepressant effects of ketamine. Although categorized as a non-com35 petitive NMDA-R (/V-methyl-D-aspartate receptor) blocker, ketamine has rich pharmacology and it regulates a myriad number of targets. Among them the AMPA-R 20176142 prh 21 -12- 2017 (a-amino-3-hydroxy-5-methyl-4-isoxazolepropionicacid receptor) has received considerable attention. Emerging evidence suggests that ketamine facilitates glutamatergic excitability leading into enhanced AMPA-R signaling, which in turn augments synaptic plasticity through the BDNF (brain-derived neurotrophic factor) receptor 5 TrkB (Autry et al. 2011, Nature. 475, 91-95; Duman and Aghajanian 2012, Science. 338, 68-72; Li et al. 2010, Science. 329, 959-964; Rantamäki and Yalcin, 2016, Prog. Neuropsychopharmacol. Biol. Psychiatry. 64, 285-292). Inhibition of ΟδΚ3β (glycogen synthase kinase 3β) kinase, another molecular event associated with ketamine's therapeutic effects (Beurel et al. 2011, Mol. Psychiatry. 16, 1068-1070), 10 also contributes to enhanced AMPA-R function (Beurel et al. 2016, Bipolar Disord. 18, 473-480). Most notably, a recent preclinical report indicates that the metabolic byproduct of ketamine, a putative positive allosteric AMPA-R modulator c/s-6-hydroxynorketamine (HNK), is responsible for the antidepressant effects of ketamine (Zanos et al. 2016, Nature. 533, 481-486). This hypothesis, however, conflicts with 15 investigations pinpointing the critical role of NMDA-R blockade and the promising clinical observations with some other NMDA-R antagonists (Collinghdge et al. 2017, Biol. Psychiatry. 81, e65-e67). Of these agents the nitrous oxide (Nagele et al. 2015, Biol. Psychiatry. 78, 10-18) (N2O, “laughing gas”) is particularly interesting since it has very fast kinetics and is essentially un-metabolized in the body. Specif20 ically, the brain concentrations of N2O and thereby its direct pharmacological actions rapidly cease upon gas discontinuation; well before the antidepressant effects become evident. To understand rapid antidepressant mechanisms of N2O, we adopted the treatment 25 protocol used in the clinical study by Nagele et al in depressed patients (Nagele et al. 2015, Biol. Psychiatry. 78, 10-18) and investigated how N2O regulates biological markers implicated in rapid antidepressant effects in the adult rodent brain. We focused our studies to medial prefrontal cortex, a brain region associated in the pathophysiology of depression and antidepressant actions. Specifically, mice received 30 continuous 50% of N2O for an hour after which the animals breathed room air for another hour. This treatment readily increased the expression of mRNAs (c-fos, arc, bdnf, zif-268, homer-1 A, egr-2, mkp-1, synapsin) connected with cortical excitability and rapid-acting antidepressant effects (Fig. 1A). Unexpectedly, however, phosphorylation of TrkB and phosphorylation of ΟδΚ3β into the inhibitory serine-9 resi35 due remained unaltered (Fig. 1A). When samples were collected from mice euthanized during N2O administration similar observations were seen, indicating that ongoing NMDA-R blockade is not inherently coupled with TrkB and ΟδΚ3β signaling 20176142 prh 21 -12- 2017 alterations (Fig. 1B). Phosphorylation of mitogen-activated protein kinase (MAPKT202/Y204) and expression of activity-dependent immediate early genes (lEGs), however, were increased during N2O administration (Fig. 1B-C), which confirms the immediate “excitatory” effects under N2O. Notably, these changes induced by N2O 5 resemble those produced by the electroconvulsive therapy (Dyrvig et al. 2014, Gene. 539, 8-14; Li et al. 2010, Science. 329, 959-964), and sleep deprivation (Cirelli et al. 1995, J. Sleep Res. 4, 92-106), which also rapidly alleviates depression in a subset of patients. Unlike ketamine HNK acts only as a weak NMDA-R antagonist (Suzuki et al. 2017, Nature. 546, E1-E3) and is thus devoid of psychotomimetic and anesthetic properties even at high doses (Zanos et al. 2016, Nature. 533, 481-486). Instead, HNK facilitates AMPA-R function, which is considered as its main pharmacological action (Zanos et al. 2016, Nature. 533, 481-486). To investigate whether AMPA-R activa15 tion regulates TrkB and GSK33 phosphorylation, we subjected mice to HNK and ketamine treatments. The phosphorylation levels of TrkB and ΟδΚ3β remained, however, unaltered 30 min after HNK injections (Fig. 2A). More inthguingly, subanesthetic ketamine produced also only minor acute phosphorylation changes on TrkB and GSK3P (Fig. 2A-D). The phosphorylation of p70S6kT421/S424, a kinase down20 stream of the TrkB-mTor pathway, also remained unchanged by these treatments (Fig. 2A-D). In contrast, and more unexpectedly, the ability of ketamine to acutely regulate these molecular events increased dose-dependently and most significant effects were observed with anesthetic doses (Fig. 2A-D-3A). Notably, an anesthetic dose of ketamine increased phosphorylation of TrkB, p70S6k and ΟδΚ3β within 3 25 min when its metabolism into HNK is likely marginal (Fig. 3B). Most importantly, a sedative dose of ketamine deuterated at the C6 position, a modification that reduces its metabolism into HNK (Zanos et al. 2016, Nature. 533, 481-486), recapitulated the acute effects of equivalent dose of ketamine on TrkB and ΟδΚ3β phosphorylation (Fig. 2B). Collectively these data indicate that the ability of ketamine to acutely 30 regulate TrkB and ΟδΚ3β signaling is by no means restricted to subanesthetic doses and that HNK is not responsible for these effects of ketamine. To provide further insights for the intriguing differential responses of subanesthetic versus sedative-anesthetic doses of ketamine and apparent lack of the acute effects 35 of HNK and N2O on TrkB and 6δΚ3β signaling we performed time-lapsed quantitative pharmaco-EEG recordings in freely moving mice subjected to the treatments. 20176142 prh 21 -12- 2017 Ketamine increased high frequency gamma oscillations in a dose-dependent manner (Fig. 2C-D, 4). Low and high ketamine doses produced, however, different acute changes within the lower EEG frequencies. While doses <10 mg/kg produced no clear alterations, higher doses increased frequencies between ~1-5 Hz (delta, low 5 theta) and between ~20-50 Hz (beta, low gamma) and reduced ~10 Hz (alpha) (Fig. 2C-D, 4). Other than a slight increase in alpha and gamma oscillations HNK did not produce clear acute alterations in EEG spectra (Fig. 2D). Apart from slight dampening of low gamma oscillations (and initial dampening of delta oscillations), no major sustained EEG alterations was observed during N2O administration (Fig. 1, 5). 10 Further, we analyzed the EEG post-ISEO to see whether such evoked slow EEG oscillations in response to preceding N2O exposure can be recapitulated in rodents. Indeed, EEG oscillations at the range of ~1 -5 Hz gradually, yet transiently, emerged above baseline upon withdrawal from an hour exposure to 50% N2O (Fig. 1D). Notably, increased slow EEG oscillations appeared rapidly after a short exposure to 15 higher concentrations of N2O (Fig. 1E, 5A-B). Beta and low gamma oscillations were reduced during this N2O treatment but these alterations rapidly normalized upon gas withdrawal (Fig. 1D-E, 5A-B). Altogether these data prompted us to collect brain samples for western blot analyses during these recovery periods after exposing the animals to varying concentrations of N2O. Remarkably, phosphorylation of 20 TrkB, ΟδΚ3β and p70S6k were up-regulated in these samples, while most prominent changes were seen with 65% N2O (Fig. 1F, Fig. 6). Collectively these data demonstrate that N2O can indeed regulate TrkB and ΟδΚ3β signaling in the brain but these responses appear only after gas withdrawal during which slow EEG oscillations become facilitated. Observations obtained with N2O guided us to test whether ketamine might evoke similar EEG responses at subanesthetic doses that are shown to increase cortical excitability and to bring rapid antidepressant effects (Autry et al. 2011, Nature. 475, 91-95; Li et al. 2010, öcience. 329, 959-964). While a low dose of ketamine again 30 failed to produce acute increase in slow EEG oscillations, these oscillations emerged gradually and only after the peak of pharmacological effect of ketamine (Fig. 1G, 7). Interestingly, gamma and slow-wave delta oscillations showed inverse time-dependent regulation after ketamine (Fig. 1G, 7). These effects of subanesthetic N2O and ketamine on EEG resemble, but are qualitatively quite different, to 35 those produced by flurothyl-induced seizure (Fig. 1H), another historical treatment of depression (Krantz et al. 1957, öcience. 126, 353-354). ölow-wave delta and theta oscillations emerged rapidly after flurothyl withdrawal while other overshooting 20176142 prh 21 -12- 2017 EEG oscillations were not noted. Phosphorylation levels of TrkB, ΟδΚ3β and p70S6kwere, however, significantly increased during the post-ictal period (Fig. 1H), further demonstrating that slow EEG oscillations predict these signaling responses. Direct facilitation of slow EEG oscillations and TrkB signaling without preceding cortical excitability is not translated into antidepressant responses Slow EEG oscillations are characteristic for sedation and reduced vigilance states and are induced by drugs carrying sedative properties. Indeed, we have previously 10 shown that conventional antidepressants, particularly tricyclics that block Hi-R (histamine-1 receptors), activate TrkB within similar time frame as ketamine (Rantamäki et al. 2007, Neuropsychopharmacol. 32, 2152-2162; Saarelainen et al. 2003, J. Neurosci. 23, 349-357), albeit this controversy has received little attention (Rantamäki and Yalcin, 2016, Prog. Neuropsychopharmacol. Biol. Psychiatry. 64, 15 285-292). To test the intriguing possibility that mere sedation co-associates with increased TrkB and ΟδΚ3β phosphorylation changes we injected mice with a hypnotic-sedative drug medetomidine (an oc2-noradrenergic receptor agonist) that specifically increase slow EEG oscillations (Fig. 8A-B). Notably, while medetomidine readily regulates TrkB and ΟδΚ3β signaling it concomitantly dampens 20 MAPKT202/Y204 phosphorylation and gamma oscillations (Fig. 2B, 12). Moreover, if anything medetomidine reduces IEG expression (Fig. 11). Our report links ongoing slow EEG activity with some of the key molecular signaling events connected with rapid antidepressant effects. The differential mechanistic 25 principles underlying the abilities of rapid-acting antidepressants, conventional antidepressants and hypnotic-sedative drugs to regulate slow EEG oscillations and thereby TrkB and ΟδΚ3β signaling suggests that activation and inhibition of TrkB and ΟδΚ3β, respectively, are not per se sufficient for rapid antidepressant responses. We tested this hypothesis with medetomidine in the learned helplessness 30 paradigm, which has strong construct validity regarding depression (Vollmayr and Henn, 2001, Brain Res. Brain Res. Protoc. 8,1-7). In this model a rodent is exposed to inescapable mild foot shocks and subsequently tested for a deficit (helplessness) of acquired avoidance. Subanesthetic dose of ketamine rapidly (within 24 h) ameliorated the avoidance deficit while medetomidine showed no effect (Fig. 8D). Col35 lectively our data support a notion that consecutive regulation of cortical excitability and regulation of TrkB and ΟδΚ3β during the rebound slow EEG oscillations is 20176142 prh 21 -12- 2017 shared neurobiological phenomenon for interventions that can bring rapid antidepressant responses in humans. This hypothesis is supported by clinical studies with ECT. Indeed, rather than mere seizure manifestation, post-ictal (i.e. after seizure) emergence of slow EEG oscillations have been associated with the efficacy and 5 onset of action of ECT (Nobler M. S. et al., 1993, Biol. Psychiatry 34, 321-330; Sackeim H. A. et al., 1993, N. Engl. J. Med. 328, 839-846) (see Fig. 1H). Therapeutic efficacy of rapid-acting antidepressants may be determined by utilizing slow neural oscillations Results of the present study are summarized in Figures 13 and 14. The present disclosure proves that by monitoring slow neural oscillations from the cortex of the brain of a subject administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring, it is possible to determine the therapeutic efficacy 15 of said rapid-acting antidepressant(s) based on fluctuations on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) after the administration under the influence of said rapid-acting antidepressants) in said subject. In a specific embodiment the electrophysiological monitoring revealing more slow oscillations in the “I phase” compared to the Έ phase” indicates 20 the therapeutic efficacy. In a very specific embodiment the electrophysiological monitoring revealing at least 5%, 10%, 15% or more slow oscillations in the “I phase” compared to the Έ phase” indicates the therapeutic efficacy or outcome of the rapid-acting antidepressant. In a specific embodiment any treatment, which produces sufficient rebound inhibition in the cortex possess rapid antidepressant effects. Inhibition can be monitored using e.g. EEG/MEG (slow neural oscillations: 1-6 Hz) and/or any other physiological mean correlated with the emergence of aforesaid changes. In another specific embodiment any intervention transiently (e.g. 1 s - 2 h) facilitating brain excitability, 30 which produces sufficient rebound inhibition in the cortex, possess rapid antidepressant effects. Sufficient inhibition can be monitored using e.g. EEG/MEG (slow neural oscillations: 1-6 Hz (e.g. 5 %, 10 %, 15 % or more slow oscillations in the I phase compared to the E phase)) and/or any physiological mean or clinical evaluation correlated with the emergence of aforesaid changes. 20176142 prh 21 -12- 2017 Figure 13 shows the essential interplay between “excitation” (E phase) and “inhibition” (I phase) caused by rapid-acting antidepressants. Rapid-acting antidepressants produce cortical excitability that evokes a homeostatic emergence of slow neural oscillations, during which molecular events intimately implicated with rapid 5 antidepressant effects become altered: activation of TrkB receptor and inhibition of ΟδΚ3β (glycogen synthase kinase 3β). Such evoked homeostatic brain responses beneficial against depression can be rapidly produced and reproduced and controlled with interventions capable of producing transient cortical excitability. Monitoring of the time-lapsed emergence of slow wave neuronal network oscillations during 10 the treatment(s) can be utilized to control antidepressant efficacy. All figures 1-12 and 14, especially e.g. figures 1 and 8, support figure 13. Figure 14 illustrates three example schemes (in a time line) enabled by the present invention. Scheme 1 describes a method for determining a therapeutic efficacy of a 15 rapid acting antidepressant by monitoring slow neural oscillations. Desired alterations of slow neural oscillations reveal the presence of therapeutic effects (e.g. rebound oscillations or more slow neural oscillations in the I phase compared to the E phase). All figures 1-14, especially e.g. figures 1 and 8, and figures 2-3, 5-6, support Scheme 1. Schemes 2 and 3 describe a real time method for optimizing rapid acting 20 antidepressant treatment by monitoring slow neural oscillations. If a desired response is not achieved with a rapid acting antidepressant treatment said treatment may be e.g. repeated (e.g. figure 1, 5) or modified (e.g. adjusting dose) (e.g. figure 1) or replaced with another rapid acting antidepressant in order to arrive at a desired or improved outcome (e.g. more slow neural oscillations in the I phase compared to 25 the E phase). All figures 1-14, especially e.g. figure 4, support Schemes 2 and 3. Schemes 1-3 are also applicable e.g. for methods of screening novel rapid acting antidepressants or combinations thereof. SEQUENCE LISTING <110>Helsingin yliopisto<120>Methods for determining the therapeutic efficacy of rapid-acting antidepressants and personalized antidepressant therapy related thereto<130>BP212255<160>22<170>Patentin version 3.5<210><211><212><213>119DNAArtificial Sequence<220><223>oligonucleotide primer <400> 1 aagtgccgag ctgagatgc19 <210><211><212><213>219DNAArtificial Sequence<220><223>oligonucleotide primer <400> 2 cgacctgtgc aaccctttc19 <210><211><212><213>320DNAArtificial Sequence<220><223>oligonucleotide primer <400> 3 ggctgtattc ccctccatcg20 <210><211><212><213>422DNAArtificial Sequence<220><223>oligonucleotide primer <400> 4 ccagttggta acaatgccat gt22 <210> 5 <211> 27 <212><213>DNA Artificial Sequence<220><223>oligonucleotide primer <400> 5 accgaagtat gaaataacca tagtaag27 <210><211><212><213>627DNAArtificial Sequence<220><223>oligonucleotide primer <400>6 tgtttacttt gacaagtagt gactgaa27 <210><211><212><213>724DNAArtificial Sequence<220><223>oligonucleotide primer <400> 7 gaaggctgca ggggcataga caaa24 <210><211><212><213>825DNAArtificial Sequence<220><223>oligonucleotide primer<400>8 tacacaggaa gtgtctatcc ttatg 25 <210><211><212><213>919DNAArtificial Sequence<220><223>oligonucleotide primer<400>9 cgggtttcaa cgccgacta 19 <210><211><212><213>1021DNAArtificial Sequence <220> <223> oligonucleotide primer <400> 10 ttggcactag agacggacag a 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 11 gccaaggccg tagacaaaat c <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 12 ccactccgtt catctggtca <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 13 ggtgaaggtc ggtgtgaacg g <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 14 catgtagttg aggtcaatga aggg <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 15 ggcaaacact gtttatggac tgg <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 16 gtaattcagt caacttgagc aacc <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 17 ctgctttgat caacgtctcg <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 18 aagctgaagt tgggggagat <210> <211> <212> <213> <220> <223> <400> DNA Artificial Sequence oligonucleotide primer acaccgactg ggcaaaata <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 20 gtcacagaag ttgtagacag aatg <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 21 tcctctccat cacatgcctg <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide primer <400> 22 cactctgaca catgctccag
权利要求:
Claims (23) [1] Claims 1. A method for determining a therapeutic efficacy of a rapid-acting antidepressant, 5 wherein the method comprises: monitoring slow neural oscillations from the cortex of the brain of a subject administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring, and determining a therapeutic efficacy of said rapid-acting antidepressant(s) based 10 on fluctuations on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) after the administration under the influence of said rapid-acting antidepressant(s) in said subject. [2] 2. The method for determining a therapeutic efficacy of a rapid-acting antidepres15 sant of claim 1, wherein the electrophysiological monitoring revealing more slow oscillations in the I phase compared to the E phase indicates the therapeutic efficacy. [3] 3. The method for determining a therapeutic efficacy of one or more rapid-acting 20 antidepressants of any one of claims 1 - 2, wherein duration of the E phase is 1 second - 2 hours and/or duration of the I phase is 5 min - 1 hour and/or duration of the combination of E and I phases is 5 min - 3 hours. [4] 4. The method for determining a therapeutic efficacy of one or more rapid-acting 25 antidepressant(s) of any one of claims 1 - 3, wherein the electrophysiological monitoring is an electroencephalogram (EEG) and/or magnetoencephalography (MEG) and/or other mean. [5] 5. The method for determining a therapeutic efficacy of one or more rapid-acting 30 antidepressant(s) of any one of claims 1 - 4, wherein slow neural oscillation frequency bands comprise or have the frequency range 1 - 6 Hz. [6] 6. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant(s) of any one of claims 1 - 5, wherein concurrent emergence of E 35 phase and I phase indicates better therapeutic efficacy of the rapid-acting antidepressants). 20176142 prh 21 -12- 2017 [7] 7. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant(s) of any one of claims 1 - 6, wherein the therapeutic efficacy is for nervous system disorder associated with compromised plasticity, e.g. a disorder is selected from the group consisting of depression, anxiety, addiction, neurodegen- 5 erative disorder, brain trauma, post-traumatic stress disorder and neuropathic pain. [8] 8. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant(s) of any one of claims 1 - 7, wherein the rapid-acting antidepressant is a pharmacological compound that has one or 10 more of the following properties: NMDA-R blockade (e.g. ketamine, nitrous oxide), GABAa-R blockade (e.g. flurothyl), GABAa-R positive allosteric modulation (e.g. gamma-hydroxybutyrate), GHB-R agonism (e.g. gamma-hydroxybutyrate), AMPAR positive allosteric modulation (e.g. hydroxynorketamine), 5-HT2A-R agonism (e.g. psilocybin), alfa2-R antagonism (e.g. atipamezol), anti-muscarinic, up-regulate im15 mediate-early genes, produce seizures, evoke glutamate release; or any related pharmaceutical antidepressant or any combination thereof, and/or the rapid-acting antidepressant(s) is(are) a non-pharmacological antidepressant selected from the group consisting of sleep deprivation, electroconvulsive therapy (ECT), (repetitive) transcranial magnetic stimulation (TMS), transcranial direct cur20 rent stimulation (tDCS), vagal nerve stimulation, photic stimulation, direct current stimulation, hyperthermia, hypothermia, cortical cooling, or related physiological method, or any combination thereof and/or the rapid-acting antidepressants are a combination of one or more pharmacological rapid-acting antidepressants and one or more non-pharmacological rapid-acting antidepressants. [9] 9. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant(s) of any one of claims 1 - 8, wherein the rapid-acting antidepressant has been administered intravenously, intra-arterially, intramuscularly, intranasally, by an oral administration or by inhalation. [10] 10. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant(s) of any one of claims 1 - 9, wherein the rapid-acting antidepressant has been administered on the same day when the therapeutic efficacy is determined. [11] 11. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant(s) of any one of claims 1-10, wherein the method further comprises 20176142 prh 21 -12- 2017 monitoring neurophysiological data, behavioral data, respiratory data, blood flow data, cardiac data, galvanic skin response data, data on biochemical marker(s) or any combination thereof, specifically after the administration under the influence of said rapid-acting antidepressant(s) in said subject. [12] 12. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant(s) of any one of claims 1-11, wherein no further monitoring is needed. 10 [13] 13. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant of any one of claims 1-12, wherein said monitoring of the slow neural oscillations or determining the therapeutic efficacy is repeated once or twice or several times after the subject has further been administered with the rapid-acting antidepressant for the second time, third time or several times e.g. during the same 15 day as the first administration, respectively, or after the subject has further been administered with another rapid-acting antidepressant. [14] 14. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant of any one of claims 1-13, wherein said determining is carried out 20 in real-time. [15] 15. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant of any one of claims 1-14, wherein a therapeutic state of the brain is obtained. [16] 16. The method for determining a therapeutic efficacy of one or more rapid-acting antidepressant(s) of any one of claims 1-15, wherein TrkB and/or GSKp signaling is(are) indirectly determined by monitoring slow neural oscillations or sedative state of the individual. [17] 17. A real-time method of optimizing antidepressant treatment, wherein the method comprises monitoring slow neural oscillations from the cortex of the brain of a subject administered with one or more rapid-acting antidepressant(s) by electrophysiologi35 cal monitoring, and determining a therapeutic efficacy of said rapid-acting antidepressant(s) based on fluctuations on slow neural oscillations before the administration and during E 20176142 prh 21 -12- 2017 phase (excitation) and I phase (inhibition) after the administration under the influence of said rapid-acting antidepressant(s) in said subject, and optimizing the rapid-acting antidepressant treatment. 5 [18] 18. The real-time method of optimizing antidepressant treatment of claim 17, wherein optimizing the rapid-acting antidepressant treatment is selected from the group consisting of i) continuing said treatment, ii) optimizing the dosing of said rapid-acting antidepressant or the dosing of another rapid-acting antidepressant, iii) stopping the treatment and iv) combining said rapid-acting antidepressant treatment 10 with another pharmaceutical such as another rapid-acting antidepressant. [19] 19. The real-time method of optimizing antidepressant treatment of claim 17 or 18, wherein the brain state obtained by administering a rapid-acting antidepressant is reproduced or optimized for inducing plasticity. [20] 20. A method of screening novel rapid-acting antidepressants, wherein the method comprises monitoring slow neural oscillations from the cortex of the brain of a subject administered with a pharmaceutical by electrophysiological monitoring, and 20 determining a rapid-acting antidepressant therapeutic efficacy of said pharmaceutical based on fluctuations on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) after the administration under the influence of said pharmaceutical in said subject. 25 [21] 21. A method of treating a subject with a rapid-acting antidepressant, wherein the method comprises: monitoring slow neural oscillations from the cortex of the brain of a subject to be administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring, 30 administering to the subject in need thereof one or more rapid-acting antidepressants), monitoring slow neural oscillations from the cortex of the brain of the subject administered with one or more rapid-acting antidepressant(s) by electrophysiological monitoring, and 35 determining a therapeutic efficacy of said rapid-acting antidepressant(s) based on fluctuations on slow neural oscillations before the administration and during E phase (excitation) and I phase (inhibition) after the administration under the influence of said rapid-acting antidepressant(s) in said subject. [22] 22. The method of treating a subject with a rapid-acting antidepressant of claim 21, 5 wherein the method further comprises optimizing the rapid-acting antidepressant treatment. [23] 23. The method of treating a subject with a rapid-acting antidepressant of claim 21 or 22, wherein optimizing the rapid-acting antidepressant treatment is selected from 10 the group consisting of i) continuing said treatment, ii) optimizing the dosing of said rapid-acting antidepressant or the dosing of another rapid-acting antidepressant, iii) stopping the treatment and iv) combining said rapid-acting antidepressant treatment with another pharmaceutical such as another rapid-acting antidepressant.
类似技术:
公开号 | 公开日 | 专利标题 Ziemann2004|TMS and drugs Hentschke et al.2005|Neocortex is the major target of sedative concentrations of volatile anaesthetics: strong depression of firing rates and increase of GABAA receptor‐mediated inhibition Xiao et al.2008|Chemotherapy-evoked neuropathic pain: Abnormal spontaneous discharge in A-fiber and C-fiber primary afferent neurons and its suppression by acetyl-L-carnitine Antal et al.2010|Brain-derived neurotrophic factor | gene polymorphisms shape cortical plasticity in humans Pavone et al.2016|Nitrous oxide-induced slow and delta oscillations Soper et al.2016|Optogenetic activation of superior colliculus neurons suppresses seizures originating in diverse brain networks Ahnaou et al.2009|Modulation of group II metabotropic glutamate receptor | elicits common changes in rat and mice sleep–wake architecture Li et al.2017|Chronic stress exacerbates neuropathic pain via the integration of stress-affect–related information with nociceptive information in the central nucleus of the amygdala Liu et al.2005|Opposing muscarinic and nicotinic modulation of hypoglossal motor output to genioglossus muscle in rats in vivo Kohtala et al.2019|Cortical excitability and activation of TrkB signaling during rebound slow oscillations are critical for rapid antidepressant responses Akeju et al.2016|GABAA circuit mechanisms are associated with ether anesthesia-induced unconsciousness Ahnaou et al.2015|Negative versus positive allosteric modulation of metabotropic glutamate receptors |: indices for potential pro-cognitive drug properties based on EEG network oscillations and sleep-wake organization in rats WO2019122525A1|2019-06-27|Methods for determining the effect of rapid-acting antidepressants and personalized antidepressant therapy related thereto Sood et al.2006|Inhibition of serotonergic medullary raphe obscurus neurons suppresses genioglossus and diaphragm activities in anesthetized but not conscious rats Broberg et al.2010|Assessment of auditory sensory processing in a neurodevelopmental animal model of schizophrenia—gating of auditory-evoked potentials and prepulse inhibition Javad-Moosavi et al.2017|Critical role of CA1 muscarinic receptors on memory acquisition deficit induced by total | and REM sleep deprivation | Zhou et al.2020|The effects of repeated transcranial direct current stimulation on sleep quality and depression symptoms in patients with major depression and insomnia Gener et al.2019|Serotonin 5-HT1A, 5-HT2A and dopamine D2 receptors strongly influence prefronto-hippocampal neural networks in alert mice: Contribution to the actions of risperidone Kohtala et al.2019|Ketamine-induced regulation of TrkB-GSK3β signaling is accompanied by slow EEG oscillations and sedation but is independent of hydroxynorketamine metabolites Griebel et al.2013|Further evidence for the sleep-promoting effects of 5-HT2A receptor antagonists and demonstration of synergistic effects with the hypnotic, zolpidem in rats Siok et al.2012|Comparative analysis of the neurophysiological profile of group II metabotropic glutamate receptor activators and diazepam: effects on hippocampal and cortical EEG patterns in rats US20200398021A1|2020-12-24|Systems and methods for driving neural activity to control brain signaling and gene expression Lim et al.2010|Attenuation of fear-like response by escitalopram treatment after electrical stimulation of the midbrain dorsolateral periaqueductal gray Ahnaou et al.2016|Translational neurophysiological markers for activity of the metabotropic glutamate receptor | modulator JNJ-40411813: Sleep EEG correlates in rodents and healthy men Ahnaou et al.2016|Modulation of mGlu2 receptors, but not PDE10A inhibition normalizes pharmacologically-induced deviance in auditory evoked potentials and oscillations in conscious rats
同族专利:
公开号 | 公开日 FI128750B|2020-11-30| WO2019122525A1|2019-06-27|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题 US10947257B2|2017-10-09|2021-03-16|Compass Pathfinder Limited|Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use|WO2007143663A2|2006-06-05|2007-12-13|The Regents Of The University Of California|Quantitative eeg method to identify individuals at risk for adverse antidepressant effects| US20080159958A1|2006-12-27|2008-07-03|Abbott Laboratories|Determination of histamine-3 bioactivity| US20120165696A1|2009-06-03|2012-06-28|Martijn Wilco Arns|Method for assessing the susceptibility of a human individual suffering from a psychiatric or neurological disorder to neuromodulation treatment| ES2836905T3|2014-03-31|2021-06-28|Univ Maryland|Use of negative modulators of gaba receptors containing alpha5 subunits as fast-acting antidepressants| WO2015175531A1|2014-05-12|2015-11-19|Steerwasher, Llc|Compositions and methods for treating depressive disorders| WO2016029211A1|2014-08-22|2016-02-25|The General Hospital Corporation|Systems and methods for discovery and characterization of neuroactive drugs|CN112545515A|2020-12-04|2021-03-26|清华大学|Shooting performance detection and evaluation method and device under competitive pressure|
法律状态:
2020-11-30| FG| Patent granted|Ref document number: 128750 Country of ref document: FI Kind code of ref document: B |
优先权:
[返回顶部]
申请号 | 申请日 | 专利标题 FI20176142A|FI128750B|2017-12-21|2017-12-21|Methods for determining the therapeutic efficacy of rapid-acting antidepressants and personalized antidepressant therapy related thereto|FI20176142A| FI128750B|2017-12-21|2017-12-21|Methods for determining the therapeutic efficacy of rapid-acting antidepressants and personalized antidepressant therapy related thereto| PCT/FI2018/050954| WO2019122525A1|2017-12-21|2018-12-20|Methods for determining the effect of rapid-acting antidepressants and personalized antidepressant therapy related thereto| 相关专利
Sulfonates, polymers, resist compositions and patterning process
Washing machine
Washing machine
Device for fixture finishing and tension adjusting of membrane
Structure for Equipping Band in a Plane Cathode Ray Tube
Process for preparation of 7 alpha-carboxyl 9, 11-epoxy steroids and intermediates useful therein an
国家/地区
|